from . import CONFS_PATH
from ..core.coordinates_3d import Coords
from ..core.strand import Strand
from ..core.motif import Motif
from .loops import Loop
# Shared functionality for all Aptamers
[docs]
class Aptamer(Motif):
"""
Base class for all aptamers, inheriting from the Motif class.
This class is used to create aptamers with specific sequences and coordinates.
At the moment, it does not add any additional functionality to the Motif class,
but it can be used to create a common interface for all aptamers or for screening
motifs in an origami.
"""
pass
# Create the Aptamer class also inheriting from the selected base class
[docs]
def create_aptamer(*args, inherit_from: classmethod = None, **kwargs):
"""
Create an Aptamer object, optionally inheriting from a specified base class.
Parameters
----------
args : list
Positional arguments to be passed to the Aptamer constructor.
inherit_from : classmethod, optional
A class from which the Aptamer class should inherit. If not provided,
the Aptamer class will be used as is.
kwargs : dict
Keyword arguments to be passed to the Aptamer constructor.
Returns
-------
Aptamer
An instance of the Aptamer class, optionally inheriting from the specified
inherit_from class.
"""
aptamer = Aptamer(*args, **kwargs)
if inherit_from:
aptamer = type("Aptamer", (Aptamer, inherit_from), {})(*args, **kwargs)
else:
aptamer = Aptamer(*args, **kwargs)
return aptamer
###
# FLAPS
###
[docs]
def Ispinach(**kwargs):
"""
Returns the ISpinach aptamer motif.
A fluorescent RNA aptamer modeled from PDB 5OB3.
"""
strand1 = Strand("─CUG─UU─GA─GUAGAGUGUGGGCUC─")
strand1._coords = Coords.load_from_file(CONFS_PATH / "Ispinach_1.dat")
strand2 = Strand("─GUGAGG─GU─CGG─G─UC────CAG─", start=(26, 2), direction=(-1, 0))
strand2._coords = Coords.load_from_file(CONFS_PATH / "Ispinach_2.dat")
kwargs.setdefault("join", False)
return create_aptamer([strand1, strand2], **kwargs)
[docs]
def Mango(open_left=False, **kwargs):
"""
Returns the Mango aptamer as a loop-based motif.
A fluorogenic aptamer based on PDB 5V3F.
"""
strand = Strand(
"─GUGC─GAA─GG─GAC─GG─UGC╰│╭────GG─AGA─GG─AGA─GCAC─",
start=(23, 2),
direction=(-1, 0),
)
strand._coords = Coords.load_from_file(CONFS_PATH / "Mango.dat")
kwargs["inherit_from"] = Loop
return create_aptamer(strands=strand, open_left=open_left, **kwargs)
[docs]
def MalachiteGreen(open_left=False, **kwargs):
"""
Returns the full Malachite Green aptamer motif.
Derived from the structure in PDB 1Q8N.
"""
strand = Strand(
"─GGAUCC───CG─A──CUGGCGA╰│╭GAGCCAGGUAACGAAUGGAUCC─",
start=(23, 2),
direction=(-1, 0),
)
strand._coords = Coords.load_from_file(CONFS_PATH / "MalachiteGreen.dat")
kwargs["inherit_from"] = Loop
return create_aptamer(strands=strand, open_left=open_left, **kwargs)
[docs]
def MalachiteGreenShort(**kwargs):
"""
Returns a truncated version of the Malachite Green aptamer.
Designed for minimal structural features. Based on PDB 1Q8N.
"""
strand1 = Strand("CC───CG─A──CUG")
strand1._coords = Coords.load_from_file(CONFS_PATH / "MalachiteGreenShort_1.dat")
strand2 = Strand("CAGGUAACGAAUGG", start=(13, 2), direction=(-1, 0))
strand2._coords = Coords.load_from_file(CONFS_PATH / "MalachiteGreenShort_2.dat")
kwargs.setdefault("join", False)
return create_aptamer(strands=[strand1, strand2], **kwargs)
[docs]
def Broccoli(**kwargs):
"""
Returns the Broccoli aptamer motif.
A fluorescent aptamer derived from PDB 7ZJ5.
"""
strand1 = Strand("GGAGAC────GGUCGGG─UC────CAG")
strand1._coords = Coords.load_from_file(CONFS_PATH / "Broccoli_1.dat")
strand2 = Strand("CUG─UC─GA─GUAGAGUGUG─GGCUCC", start=(26, 2), direction=(-1, 0))
strand2._coords = Coords.load_from_file(CONFS_PATH / "Broccoli_2.dat")
kwargs.setdefault("join", False)
return create_aptamer([strand1, strand2], **kwargs)
[docs]
def OrangeBroccoli(**kwargs):
"""
Returns the Orange Broccoli aptamer motif.
Pubblication: https://doi.org/10.1038/nchembio.2477
Structure from the Broccoli PDB 7ZJ5.
"""
strand1 = Strand("GGAGAC────GGUCGGG─UC────CAG")
strand1._coords = Coords.load_from_file(CONFS_PATH / "Broccoli_1.dat")
strand2 = Strand("CUG─UU─GA─GUAGCGUGUG─GGCUCC", start=(26, 2), direction=(-1, 0))
strand2._coords = Coords.load_from_file(CONFS_PATH / "Broccoli_2.dat")
kwargs.setdefault("join", False)
return create_aptamer([strand1, strand2], **kwargs)
[docs]
def RedBroccoli(**kwargs):
"""
Returns the Red Broccoli aptamer motif.
Pubblication: https://doi.org/10.1038/nchembio.2477
Structure from the Broccoli PDB 7ZJ5.
"""
strand1 = Strand("GGAGAC────GGUCGGG─UC────CAG")
strand1._coords = Coords.load_from_file(CONFS_PATH / "Broccoli_1.dat")
strand2 = Strand("CUG─UU─GA─GUAGUGUGUG─GGCUCC", start=(26, 2), direction=(-1, 0))
strand2._coords = Coords.load_from_file(CONFS_PATH / "Broccoli_2.dat")
kwargs.setdefault("join", False)
return create_aptamer([strand1, strand2], **kwargs)
[docs]
def Pepper(**kwargs):
"""
Returns the Pepper aptamer motif.
A compact fluorescent RNA aptamer. Based on PDB 7ZJ5.
"""
strand1 = Strand("UCCC─CAAUCGU─GGCGU─GUCG─GCCUGC")
strand1._coords = Coords.load_from_file(CONFS_PATH / "Pepper_1.dat")
strand2 = Strand("GCAGGC─ACUG─GCGCC─────────GGGA", start=(29, 2), direction=(-1, 0))
strand2._coords = Coords.load_from_file(CONFS_PATH / "Pepper_2.dat")
kwargs.setdefault("join", False)
return create_aptamer([strand1, strand2], **kwargs)
###
# Substrate binding aptamers
###
[docs]
def Biotin(**kwargs):
"""
Returns the biotin-binding aptamer motif.
Based on PDB structure 1F27.
"""
strand = Strand("────GGACCGU─CA───╮│╯GAGGACACGGU─────╭U╰AAAAA─────GUCCUCU")
strand._coords = Coords.load_from_file(CONFS_PATH / "Biotin.dat")
kwargs.setdefault("join", False)
return create_aptamer(strands=strand, **kwargs)
[docs]
def PIP3(open_left=False, **kwargs):
"""
Returns the PIP3-binding aptamer motif.
Pubblication: https://doi.org/10.1038/ncb3473
Structure generated with RNA Composer for synthetic design.
(https://doi.org/10.1093/nar/gks339, https://doi.org/10.1002/prot.26578)
"""
strand = Strand("GGGUAGACUC╰│╭──────GCUC", start=(10, 2), direction=(-1, 0))
strand._coords = Coords.load_from_file(CONFS_PATH / "PIP3.dat")
kwargs["inherit_from"] = Loop
return create_aptamer(strands=strand, open_left=open_left, **kwargs)
[docs]
def PIP3_mut1(open_left=False, **kwargs):
"""
Returns mutant 1 of the PIP3 aptamer.
Sequence-modified variant for functional screening.
Pubblication: https://doi.org/10.1038/ncb3473
Structure generated with RNA Composer for synthetic design.
(https://doi.org/10.1093/nar/gks339, https://doi.org/10.1002/prot.26578)
"""
strand = Strand("GGGUCGACUC╰│╭──────GCUC", start=(10, 2), direction=(-1, 0))
strand._coords = Coords.load_from_file(CONFS_PATH / "PIP3_mut1.dat")
kwargs["inherit_from"] = Loop
return create_aptamer(strands=strand, open_left=open_left, **kwargs)
[docs]
def PIP3_mut3(open_left=False, **kwargs):
"""
Returns mutant 3 of the PIP3 aptamer.
Sequence-modified variant for functional screening.
Pubblication: https://doi.org/10.1038/ncb3473
Structure generated with RNA Composer for synthetic design.
(https://doi.org/10.1093/nar/gks339, https://doi.org/10.1002/prot.26578)
"""
strand = Strand("GGGUAGCCUC╰│╭──────GCUC", start=(10, 2), direction=(-1, 0))
strand._coords = Coords.load_from_file(CONFS_PATH / "PIP3_mut3.dat")
kwargs["inherit_from"] = Loop
return create_aptamer(strands=strand, open_left=open_left, **kwargs)
[docs]
def PIP3_mut5(open_left=False, **kwargs):
"""
Returns mutant 5 of the PIP3 aptamer.
Sequence-modified variant for functional screening.
Pubblication: https://doi.org/10.1038/ncb3473
Structure generated with RNA Composer for synthetic design.
(https://doi.org/10.1093/nar/gks339, https://doi.org/10.1002/prot.26578)
"""
strand = Strand("GGGUAGACGC╰│╭──────GCUC", start=(10, 2), direction=(-1, 0))
strand._coords = Coords.load_from_file(CONFS_PATH / "PIP3_mut5.dat")
kwargs["inherit_from"] = Loop
return create_aptamer(strands=strand, open_left=open_left, **kwargs)
###
# Protein binding aptamers
###
[docs]
def MS2(open_left=False, **kwargs):
"""
Returns the MS2 coat protein-binding aptamer.
Based on PDB 1ZDH, extended by 3 nucleotides.
"""
strand = Strand(
"─ACAUG─A─GG─AUCA╰│╭─────CC───CAUGU─", start=(16, 2), direction=(-1, 0)
)
strand._coords = Coords.load_from_file(
CONFS_PATH / "MS2.dat", topology_file=CONFS_PATH / "MS2.top", protein=True
)
kwargs["inherit_from"] = Loop
return create_aptamer(strands=strand, open_left=open_left, **kwargs)
[docs]
def PP7(open_left=False, **kwargs):
"""
Returns the PP7 coat protein-binding aptamer.
Derived from PDB 2QUX.
"""
strand = Strand(
"─GGCAC─A─GAAG─AUAUGG╰│╭───────CUUC───GUGCC─", start=(20, 2), direction=(-1, 0)
)
strand._coords = Coords.load_from_file(
CONFS_PATH / "PP7.dat", topology_file=CONFS_PATH / "PP7.top", protein=True
)
kwargs["inherit_from"] = Loop
return create_aptamer(strands=strand, open_left=open_left, **kwargs)
[docs]
def TAR_TAT(open_left=False, **kwargs):
"""
Returns the HIV TAR-TAT binding aptamer.
Structure based on PDB 6MCE.
"""
strand = Strand(
"─GGGCAGA─UU─GAGC─C─UG╰│╭G──GAGCUC────UCUGCCC─",
start=(21, 2),
direction=(-1, 0),
)
strand._coords = Coords.load_from_file(
CONFS_PATH / "TAR_TAT.dat",
topology_file=CONFS_PATH / "TAR_TAT.top",
protein=True,
)
kwargs["inherit_from"] = Loop
return create_aptamer(strands=strand, open_left=open_left, **kwargs)
[docs]
def L7Ae(**kwargs):
"""
Returns the L7Ae protein-binding aptamer.
Structure based on PDB 1RLG.
"""
strand1 = Strand("─UCU─GA────CC─")
strand1._coords = Coords.load_from_file(CONFS_PATH / "L7Ae_1.dat")
strand2 = Strand("─GG─CGUGA─UGA─", start=(13, 2), direction=(-1, 0))
strand2._coords = Coords.load_from_file(
CONFS_PATH / "L7Ae_2.dat", topology_file=CONFS_PATH / "L7Ae_2.top", protein=True
)
kwargs.setdefault("join", False)
return create_aptamer([strand1, strand2], **kwargs)
[docs]
def Streptavidin(open_left=False, **kwargs):
"""
Returns the Streptavidin-binding aptamer.
Pubblication: https://doi.org/10.1093/nar/gkt956
Modeled using RNA Composer based on experimental data.
(https://doi.org/10.1093/nar/gks339, https://doi.org/10.1002/prot.26578)
"""
strand = Strand(
"AUGCGGCCGCCGACCAGAAUCAUGCAAGUGCGUAAGAUAGU╰│╭─────────"
"CGCG─────────────GGUCGGCGGCCGCAU",
start=(41, 2),
direction=(-1, 0),
)
strand._coords = Coords.load_from_file(CONFS_PATH / "Streptavidin.dat")
kwargs["inherit_from"] = Loop
return create_aptamer(strands=strand, open_left=open_left, **kwargs)
[docs]
def Thrombin_exosite1(open_left=False, **kwargs):
"""
Returns the thrombin exosite 1-binding aptamer.
Used for anticoagulant and structural studies.
Pubblication: https://doi.org/10.1111/j.1538-7836.2012.04679.x
Modeled using RNA Composer based on experimental data.
(https://doi.org/10.1093/nar/gks339, https://doi.org/10.1002/prot.26578)
"""
strand = Strand(
"─GGCG─GUCGAUC─ACACA╭╰GUUC╮A╯A─AC─╰││╮GUAA╰U╭AA──╯││╭─GCCAAUG╮U╯"
"ACGAGGC╭╰────A─GA─CGACUCGCC─",
start=(26, 5),
direction=(-1, 0),
)
strand._coords = Coords.load_from_file(CONFS_PATH / "Thrombin_exosite1.dat")
kwargs["inherit_from"] = Loop
return create_aptamer(strands=strand, open_left=open_left, **kwargs)
[docs]
def Thrombin_exosite2(open_left=False, **kwargs):
"""
Returns the thrombin exosite 2-binding aptamer.
Based on modified PDB structure 5DO4
(replaced fluorinated ribose with regular ribose).
"""
strand = Strand(
"-GGG-AACA-AAG-CUGA\\|/AGUA-CUU----A-CCC-", start=(18, 2), direction=(-1, 0)
)
strand._coords = Coords.load_from_file(
CONFS_PATH / "Thrombin_exosite2.dat",
topology_file=CONFS_PATH / "Thrombin_exosite2.top",
protein=True,
)
kwargs["inherit_from"] = Loop
return create_aptamer(strands=strand, open_left=open_left, **kwargs)